N A N O P R O B E S     E - N E W S

Selective N-terminal amine labeling has been described for other reactions, including PEGylation (polyethylene glycol conjugation), biotinylation, and labeling peptides with the fluorophore 7-amino-4-methylcoumarin-3-acetic acid (AMCA).

What this means is that if you select a pH comfortably below the pKa of the lysine residues, you will preferentially label at the N-terminal amine; we recommend labeling at about pH 7.5. If you wish to label at a lysine residue, you should either use a higher pH, or protect the N-terminal amine before labeling.

References:

• Natarajan, S. K.; Assadi, M., and Sadegh-Nasseri, S.: Stable peptide binding to MHC class II molecule is rapid and is determined by a receptive conformation shaped by prior association with low affinity peptides. J. Immunol., 162, 4030-4036 (1999).
  • Abstract (courtesy of the Journal of Immunology)
  • Reprint (PDF) (courtesy of the Journal of Immunology)

• Selo, I, Negroni, L, Creminon, C, Grassi, J., and Wal, J. M.: Preferential labeling of alpha-amino N-terminal groups in peptides by biotin: application to the detection of specific anti-peptide antibodies by enzyme immunoassays. J. Immunol. Meth., 199, 127-38 (1996).
  • Abstract (courtesy of the Science Direct)

With gel filtration, the critical quantity is the ratio of the injection volume (the size of the mixture you inject) to the column volume: the injection volume you inject into the column should be less than 5 % of the total column volume. Therefore, the column volume you need will be determined by the size of the sample that you are injecting. The lower the ratio of sample : column size, the better your resolution will be.

The other factor to consider is that the smaller the column you use, generally the higher conjugate recoveries will be (less column volume for the sample to stick to, and the more concentrated fractions mean less loss if you need to concentrate them further). Therefore, if you can reduce the volume of your reaction mixture before injection so that you can use a smaller column, it will be to your benefit. A useful approach, that we use ourselves, is to concentrate the reaction mixture using membrane centrifuge concentrators (such as the Centricon series, available from Millipore) to concentrate the reaction mixtures to 0.8 mL or less before injection, then use a 50 x 0.66 cm column (volume ~17 mL) packed using bulk media. Pre-packed columns sometimes give higher resolution: the 30 x 1.0 cm columns, which have a volume of ~ 23 mL, are a good size for many separations, with an injection volume of 1.0 mL or less. Recovery will be easier, and often higher, from columns of this size than from larger ones.

A selection guide and full discussion on how to select the right gel for your separation is available in an earlier article.

Nanogold conjugates are packaged at a concentration of 0.08 mg/mL of active protein (not including the mass of the Nanogold particle), and contain close to one Nanogold particle per conjugate protein molecule. The amount and concentration in each

Our Nanogold® labeling reagents are packaged in vials of either 6 nmol or 30 nmol. Nanogold has a molecular weight of about 15,000. Therefore, for Nanogold reagents that are sold in a pure form - Monoamino Nanogold, Positively Charged Nanogold, Negatively Charged Nanogold, and Nanogold (Non-Functional), these vials will contain about 0.09 mg (for the 6 nmol size) or 0.45 mg (30 nmol) respectively.

Monomaleimido Nanogold and Mono-Sulfo-NHS-Nanogold are both lyophilized from buffer solution, and therefore, while the amount of Nanogold is the same, these products contain additional buffer salts. For Monomaleimido Nanogold, these salts will add 2.24 mg to the mass of each 6 nmol vial, or 11.20 mg to the mass of each 30 nmol portion; while for Monom-Sulfo-NHS-Nanogold, they will add 2.30 mg to the mass of 6 nmol (total material 2.39 mg), or 11.49 mg to the mass of 30 nmol (total material 11.94 mg).

More information:

• Catalog Information: Nanogold conjugates
• Catalog Information: Nanogold labeling reagents
• Technical Help: Nanogold conjugates
• Technical Help: Nanogold labeling reagents

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Combined Undecagold and Fluorescently Labeled Oligonucleotides

Powell, R. D.; Halsey, C. M. R., and Hainfeld, J. F.: Combined fluorescent and gold immunoprobes: Reagents and methods for correlative light and electron microscopy. Microsc. Res. Tech., 42, 2-12 (1998).

• Abstract (courtesy of PubMed (Medline)).

In order for fluorescence to be retained, the fluorescent tag has to be positioned sufficiently far away from the gold particle that a significant fraction is emitted directly rather than lost through energy transfer; generally, this means that the separation between the two must be greater than the Frster distance (the distance at which 50 % of absorbed energy is lost through energy transfer, and 50 % emitted as fluorescence). For Nanogold and fluorescein, the Förster distance is between 6 and 7 nm. The structure of fluorescein Fab'-FluoroNanogold and the Förster relationship between gold-fluorophore separation and fluorescence are shown below.

(left) Structure of fluorescein Fab'-FluoroNanogold, showing the separate attachment of the Nanogold and fluorescein labels; (right) Effect of fluorophore-Nanogold separation on fluorescence, showing Schematic showing Förster distance.

Well, what if you want to make FluoroNanogold probes out of smaller molecules, such as oligonucleotides? One solution is to use a smaller gold particle, which will have a shorter Förster distance and quench the fluorophore less. This approach was demonstrated by Dellaire and co-workers, who used (Undecagold as the electron microscopy marker in a novel combined fluorescent and gold-labeled double-stranded DNA probe, which binds selectively to fusion proteins of the DNA-binding proteins LacI and Tet-R that recognize specific operator sequences. Double-stranded oligonucleotides are attractive candidates for multiply labeled probes because they possess four distinct ends for functionalization, and their separation can be controlled by hybridization. Unlike single-stranded RNA and DNA aptamers, which bind extensively to DNA and RNA, the double-stranded probes were selective for proteins, and different probes could be used for the multiplexed detection of different targets.

Combined fluorescent and gold probes were prepared by labeling one strand with Cy3 and the other with undecagold. Functionalized dsDNAoligos recognized by LacI were constructed from two 41 bp single-stranded oligonucleotides encoding the symmetrical Lac operator 19 bp core sequence O-Sym (18): O-Sym-1 (*gcgtgtgccagaattgtgagcgctcacaatttcttgaatct) and O-Sym-2 (*agattcaagaaattgtgagcgctcacaattctggctcacgc), where * represents a 50 modification with biotin, Cy3 or a disulfide group linked via a (CH₂)₆ spacer; O-Sym-1 and 2 were resuspended to 200 mM and equal volumes of each were added to a 1/5 volume of 10 x annealing buffer (50 mM TrisHCl, pH 7.5, with 1 M NaCl and 0.2 mM EDTA). The mixture was boiled for 4 min at 90°C followed by slow equilibration to room temperature to allow annealing to produce a ~91 mM solution of the dsDNA O-Sym oligonucleotide. The O-Sym-1 / Cy3-O-Sym-2dsDNA oligo was treated with 0.04 M dithiothreitol (DTT) in 0.17 M Na₂HPO₄, pH 8.0) for 16 h at room temperature to cleave the disulfide bond. Thiol by-products and DTT were removed by gel filtration over a Sephadex NAP-5 column equilibrated with 20 mM Na₂HPO₄, 150 NaCl and 1 mM EDTA, pH 6.5 (conjugation buffer). The dsDNA oligo was further purified by 70% ethanol precipitation and repeated washes. The pellet was then resuspended in the conjugation buffer to a concentration of 100 mM, and 10 ml (1 nmol) of this solution was added to 10 nmol of Monomaleimido Undecagold in 1 ml conjugation buffer. The mixture was incubated at room temperature with stirring for 1 h, then at 4°C for 16 h. Functionalized dsDNA oligos were separated from excess undecagold by ethanol precipitation with excess salmon sperm DNA and repeated washes. The product was resuspended in 10 mM TrisHCl, 0.1 mM EDTA and 150 mM KCl, pH 7.5, to achieve a final oligo concentration of ~10 mM.

For correlative microscopy, SK-N-SH cells were split the day before transfection and 2 x 10⁵ cells were seeded at 10⁵ cells/mL onto 18 mm square coverslips in 8 or 6 well plates. Next day, cells were transfected with 12 mg of pGD-Flag-Lac338 and pGD-TET-PML DNA alone or combined per well using Lipofectamine 2000. Twenty-four to thirty-six hours post transfection, cells were fixed in 12 % paraformaldehyde in PBS (5 minutes), permeabilized in 0.5 % Triton X-100 (5 minutes at room temperature (RT)). After several washes in PBS, cells were blocked for 20 min at RT with O-Sym Binding/Blocking (OSB) buffer (10 mM TrisHCl pH 7.5, 0.1 mM EDTA, 150 mM KCl, 600 mg/ml of sheared herring sperm DNA and 200 mg/mL BSA). Cells were immediately hybridized for 12 h at 37°C with the Cy and undecagold-labeled dsDNA O-Sym oligo alone or combined with dsDNA Tet-O oligo (labeled with either Cy5, biotin or both) in OSB buffer at a concentration of 50100 nM. Coverslips were washed three times with PBS and mounted in anti-fade reagent for immediate immunofluorescence detection. For electron spectroscopic observation, the cells were post-fixed in 8 % paraformaldehyde and 2 % glutaraldehyde for 5 minutes at RT after labeling, then silver enhanced for 30 min at room temperature using a silver enhancement kit for LM or EM (Electron Microscopy Sciences). EM enhancement was performed 3 times, using fresh enhancement solution each time. Cells were then dehydrated in a series of graded ethanol washes (30, 50, 70 and 95 %) before Quetol 651 resin (EM Science) infiltration, curing and sectioning.

Images of cells of interest were collected by both fluorescence microscopy, and by electron spectroscopic imaging, preferred for its superior distinction of nucleotides and proteins, using a Tecnai 20 TEM (FEI) at 200 kV, equipped with an imaging spectrometer (Gatan). Elemental maps were generated by dividing the element-enhanced post-edge image by the pre-edge image following alignment by cross-correlation; net ratio elemental maps were derived from pre- and post-edge images recorded at 120 and 155 eV (LII,III edge) for phosphorus, and at 385 and 415 eV (K edge) for nitrogen.

This probe could be used specifically for multiple labeling in the presence of a functionalized dsDNA oligo recognized by TetR, constructed from the41 bp oligonucleotides Tet-O-1 (*tcgagtttactccctatcagtgatagagaacgtatgtcgcc) and Tet-O-2 (*ggcgacatacgttctctatcactgatagggagtaaactcgt) (where * is a 50 modification with either biotin or Cy5). Using the fluorescent and the combined fluorescent and gold-labeled dsDNA oligonucleotide, the authors localized within the nucleus a TetR-PML fusion protein within promyelocytic leukaemia protein (PML) bodies by LM, and a LacI-SC35 fusion protein within nuclear speckles by correlative light and electron microscopy (LM/EM).

Reference:

Dellaire, G.; Nisman, R.; Eskiw, C. H., and Bazett-Jones, D. P.: In situ imaging and isolation of proteins using dsDNA oligonucleotides. Nucleic Acids Res., 32, e165 (2004)

• Abstract (courtesy of Nucleic Acids Research).

More information:

• Undecagold labeling reagents - Catalog information
• Undecagold - Technical help
• Undecagold - Nucleotide labeling references
• Undecagold - References sorted by application
• FluoroNanogold - Catalog information
• FluoroNanogold - Technical help

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Nanogold Labeling of Plant Tissues

Roots of c-MycAAP3-expressing tobacco plants were embedded in 5 % low melting temperature agarose. Blocks were microtome sectioned (~100 micrometers). Sections were fixed immediately in 3 % formaldehyde in PBS for 30 min on ice, washed three times with PBS (58 mM Na₂HPO₄, 15 mM NaH₂PO₄, 68 mM NaCl, pH 7.4, and 6.7 mM EGTA), and labeled with mouse monoclonal anti-c-Myc antibody overnight at 4°C. The first antibody was visualized by either FITC-conjugated goat anti-mouse or Cy3-conjugated goat anti-mouse antibodies.

Whole mount immunodetection on Arabidopsis roots was performed essentially as described in Lauber et al. (reference below). Roots were fixed in 4 % paraformaldehyde in PBS (137 mM NaCl, 8.1 mM Na₂HPO₄, 2.68 mM KCl, and 1.47 mM KH₂PO₄) at room temperature under vacuum for 1 h, then squashed onto gelatine-coated microscopic slides. Coverslips were removed after dipping the slides into liquid nitrogen. After drying for at least 15 min, specimens were rehydrated for 10 min. Cell walls were partially digested with 2 % (wt/vol) driselase for 30 minutes, and the plasma membrane was permeabilized with 0.5 or 3 % Nonident P40 in 10 % DMSO-MTSB (50 mM Pipes, 5 mM EGTA, 5 mM MgSO ₄, pH 6.97.0) for ~1 hour. Non-specific interactions were blocked with 1 % (wt/vol) BSA in MTSB overnight at 4°C, and antibodies were diluted in 3% (wt/vol) BSA in MTSB and incubated at 37°C for ~3 hours.

For thin cryosection labeling, root tips were fixed with 4 % formaldehyde in MSB for 30 min, followed by fixation with 8 % formaldehyde in MSB for 45 minutes on ice. Fixed root tips were embedded in 10 % gelatine; gelatine blocks containing root tips were infiltrated in 2.1 M sucrose in PBS, pH 7.2, and frozen in liquid nitrogen. Ultrathin (100 nm) and semithick cryosections (300 nm) were obtained using a cryo-ultramicrotome at -100°C and -80°C, respectively. Thawed cryosections were incubated with monoclonal anti-c-Myc antibody (1:100) in blocking buffer (1 % milk powder, 0.5 % BSA, in PBS) for 60 min. After washing with blocking buffer, bound antibodies were detected with Cy3-conjugated goat anti-mouse antibody or Nanogold-labeled goat anti-mouse IgG followed by silver enhancement. Final embedding was done in 2 % methyl cellulose for transmission electron microscopy, or in Mowiol 4.88 for immunofluorescence microscopy.

Immunolocalization using Arabidopsis and tobacco plants expressing c-MycAAP3 revealed that AAP3 is mainly localized at the plasma membrane. The c-MycAAP3 protein was also localized in intracellular organelles and immunoelectron microscopy showed gold labeling on nuclear membrane, ER, Golgi, and multivesicular body-like vesicles. The potential role of AtAAP3 in root phloem was analyzed using insertion mutants: homozygous aap3-1 and aap3-2 mutants showed no effects in response to alterations in nitrogen nutrition, and did not behave differently from the wild type. Within the AAP family, AAP2, AAP5, and AAP6 have also been found to be expressed in roots, and may compensate for the loss of AAP3 activity in the mutants. While not elucidating its specific role, these studies support the involvement of AAP3 in amino acid transport.

References:

• Okumoto, S.; Koch, W.; Tegeder, M.; Fischer, W. N.; Biehl, A.; Leister, D.; Stierhof, Y. D., and Frommer, W. B.: Root phloem-specific expression of the plasma membrane amino acid proton co-transporter AAP3. J. Exp. Bot., 55, 2155-2168 (2004).
  • Abstract (courtesy of the Journal of Experimental Botany).
  • Reprint (PDF) (courtesy of the Journal of Experimental Botany).

• Lauber, M. H.; Waizenegger, I.; Steinmann, T.; Schwarz, H.; Mayer, U.; Hwang, I.; Lukowitz, W., and Jurgens, G.: The Arabidopsis KNOLLE protein is a cytokinesis-specific syntaxin. J. Cell Biol., 139, 1485-1493 (1997).
  • Abstract (courtesy of the Journal of Cell Biology).
  • Reprint (PDF) (courtesy of the Journal of Cell Biology).

More information:

• Nanogold conjugates: Technical help
• Nanogold labeling: References, sorted by application
• Catalog Information: Nanogold conjugates
• Product information Nanogold-antibody conjugates
• Technical Help: Immunoelectron microscopy

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Custom Synthesis at Nanoprobes

• Custom synthesis: General information and guidelines
• Custom synthesis: Terms and conditions
• Custom synthesis request form

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Other Recent Publications

References:

• Muly, E. C.; Allen, P.; Mazloom, M.; Aranbayeva, Z.; Greenfield, A. T., and Greengard, P.: Subcellular distribution of neurabin immunolabeling in primate prefrontal cortex: comparison with spinophilin. Cereb. Cortex., 14, 1398-1407 (2004).
  • Abstract (courtesy of Cerebral Cortex).
  • Reprint (PDF) (courtesy of Cerebral Cortex).

• Muly, E. C. III; Szigeti, K., and Goldman-Rakic, P. S.: D1 receptor in interneurons of macaque prefrontal cortex: distribution and subcellular localization. J Neurosci., 18, 10553-10565 (1998).
  • Abstract (courtesy of the Journal of Neuroscience).
  • Reprint (PDF) (courtesy of the Journal of Neuroscience).

Amplification method of the month is described by Dirks and Pierce, who describe triggered amplification by hybridization chain reaction (HCR) in their paper in the Proceedings of the National Academy of Sciences of the USA. In this approach, stable DNA monomers assemble only upon exposure to a target DNA fragment; the simplest incarnation uses two stable species of DNA hairpins which coexist in solution, until the introduction of initiator strands triggers a cascade of hybridization events that produces nicked double helices, analogous to alternating copolymers. The average molecular weight of the HCR products, determined by gel electrophoresis of products, varies inversely with initiator concentration. Amplification of other recognition events can be achieved by coupling HCR to aptamer triggers. This functionality allows DNA to act as an amplifying transducer for biosensing.

Reference:

Dirks, R. M., and Pierce, N. A.: Triggered amplification by hybridization chain reaction. Proc. Natl. Acad. Sci. USA., 101, 15275-15278(2004).

• Abstract (courtesy of the Proceedings of the National Academy of Sciences of the USA).

Gorm Danscher, one of the originators of the autometallographic technique, describes its application to the staining of zinc ions in this month's Journal of Histochemistry and Cytochemistry. The method reported is a modification of the Timm's immersion silver sulfide method, in which zinc ions are captured on zinc sulfide nanocrystals. One-, 2-, 4-, 12-, 16-, or 20-mm-thick tissue slices were immersed in a NeoTimm solution (NTS: 0.1 % sodium sulfide and 3 % glutaraldehyde in a 0.1 M Sørensen phosphate buffer, pH 7.4); the immersion jars were placed on a shaker and kept at 4°C. Three days later the slices were carefully rinsed twice in 0.1 M phosphate buffer for 10 min; if necessary, they can then be further developed by silver enhancement.

Reference:

Danscher, G.; Stoltenberg, M.; Bruhn, M.; Sondergaard, C.; and Jensen, D.: Immersion autometallography: histochemical in situ capturing of zinc ions in catalytic zinc-sulfur nanocrystals. J. Histochem. Cytochem., 521619-1625 (2004).

• Abstract (courtesy of the Journal of Histochemistry and Cytochemistry).

In case you are interested, the Original Timm's method...

Timm, F: Zur Histochemie der Schwermetalle. Das Sulfid-Silberverfahren. Dtsch. Z. Gerichtl. Med., 46, 706711 (1958).

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .